\usepackage[breaklinks]{hyperref}
\renewcommand{\UrlBreaks}{
	\do\/\do\&\do\:\do\.\do\-\do\=	\do\a\do\b\do\c\do\d\do\e\do\f\do\g\do\h\do\i\do\j\do\k\do\l\do\m\do\n\do\o\do\p\do\q\do\r\do\s\do\t\do\u\do\v\do\w\do\x\do\y\do\z\do\A\do\B\do\C\do\D\do\E\do\F\do\G\do\H\do\I\do\J\do\K\do\L\do\M\do\N\do\O\do\P\do\Q\do\R\do\S\do\T\do\U\do\V\do\W\do\X\do\Y\do\Z
}

\begin{center}
\begin{table*}[t]
\caption{Primers and primer properties for Pta\textit{SULTR1;1} and Pta\textit{SULTR4;1} PCR.}
\begin{tabular}{l l l r r r r l}
Primers & start & len & Tm & GC\% & any & 3' & seq\\
\hline
Pta\textit{SULTR1;1} & & & & & & & DQ906929\\
LEFT PRIMER & 881 & 24 & 60.58 & 41.67 & 6.00 & 2.00 & TTTATAACCCGTGCAGATAAGGAC\\ 
RIGHT PRIMER & 993 & 22 & 60.75 & 45.45 & 7.00 & 5.00 & CCTTTTAGCAAATGGTCACCAC\\
\hline
Pta\textit{SULTR4;1} & & & & & & & DQ906930\\
LEFT PRIMER & 2136 & 26 & 60.16 & 42.31 & 7.00 & 3.00 & GGCACTGCGTATATATGATATCTGTC\\
RIGHT PRIMER & 2249 & 25 & 60.64 & 36.00 & 4.00 & 3.00 & AAACCTTACGACAAGTATTGCATTG\\
\end{tabular}
\smallskip
\caption{Composition of PCR solutions and PCR reaction program.}
\hskip-1.2cm
\begin{tabular}{l r | l r | l l}
master mixture & $\sum$ 90~$\mu$l & primer dilution & $\sum$ 5 $\cdot$ 2~$\mu$l & PCR program & settings\\
\hline
H$_2$O & 62.5~$\mu$l & & & initial denaturation & 95~\celsius~/ 5 min\\
10x Taq Buffer & 10~$\mu$l & 0.8~$\mu$mol & ~8~$\mu$l $\rightarrow$ +~ ~8~$\mu$l $\leftarrow$ + 84~$\mu$l H$_2$O & standard cycle & 42 repetitions\\
25 mM MgCl$_2$ & 10~$\mu$l & 1.0~$\mu$mol & 10~$\mu$l $\rightarrow$ + 10~$\mu$l $\leftarrow$ + 80~$\mu$l H$_2$O & denaturation step & 95~\celsius~/ 30 sec\\
cDNA & 5~$\mu$l & 1.2~$\mu$mol & 12~$\mu$l $\rightarrow$ + 12~$\mu$l $\leftarrow$ + 76~$\mu$l H$_2$O & annealing step & 55~\celsius~/ 30 sec\\
10 mM dNTPs & 2~$\mu$l & 1.4~$\mu$mol & 14~$\mu$l $\rightarrow$ + 14~$\mu$l $\leftarrow$ + 72~$\mu$l H$_2$O & elongation step & 72~\celsius~/ 1 min\\
Taq Polymerase & 0.5~$\mu$l & negative control & 2~$\mu$l H$_2$O & final elongation & 72~\celsius~/ 10 min\\
\end{tabular}
\end{table*}
\end{center}

%Seitenumbruch in Fußnoten verhindern
\interfootnotelinepenalty=10000

\begin{tabular}{@{}lr|l@{}r|ll@{}}

\DeclareLanguageMapping{american}{american-apa}

\DeclareLanguageMapping{german}{german-apa}

\DefineBibliographyStrings{ngerman}{andothers={et\addabbrvspace al\adddot}}

\addplot [color=mycolor1,solid,line width=2.0pt]
\addlegendentry{A 1}
\addplot [color=mycolor2,solid,line width=2.0pt]
\addlegendentry{A 2}
\addplot [color=mycolor3,solid,line width=2.0pt]
...
\addplot [color=mycolor100,solid,line width=2.0pt]
\addlegendentry{A 100}